No Evidence of Murine Leukemia Virus-Related Viruses in Live Attenuated Human Vaccines
Events
Loading … Spinner

Mendeley | Further Information

{"title"=>"No evidence of murine leukemia virus-related viruses in live attenuated human vaccines", "type"=>"journal", "authors"=>[{"first_name"=>"William M.", "last_name"=>"Switzer", "scopus_author_id"=>"7006277806"}, {"first_name"=>"Hao Qiang", "last_name"=>"Zheng", "scopus_author_id"=>"7403440935"}, {"first_name"=>"Graham", "last_name"=>"Simmons", "scopus_author_id"=>"7103069709"}, {"first_name"=>"Yanchen", "last_name"=>"Zhou", "scopus_author_id"=>"35172238000"}, {"first_name"=>"Shaohua", "last_name"=>"Tang", "scopus_author_id"=>"55265717000"}, {"first_name"=>"Anupama", "last_name"=>"Shankar", "scopus_author_id"=>"36197215200"}, {"first_name"=>"Beatrix", "last_name"=>"Kapusinszky", "scopus_author_id"=>"18836182300"}, {"first_name"=>"Eric L.", "last_name"=>"Delwart", "scopus_author_id"=>"7003328241"}, {"first_name"=>"Walid", "last_name"=>"Heneine", "scopus_author_id"=>"55628579712"}], "year"=>2011, "source"=>"PLoS ONE", "identifiers"=>{"issn"=>"19326203", "pui"=>"363132818", "doi"=>"10.1371/journal.pone.0029223", "sgr"=>"84055182539", "scopus"=>"2-s2.0-84055182539", "isbn"=>"1932-6203 (Electronic)\\r1932-6203 (Linking)", "pmid"=>"22216219"}, "id"=>"8959ef72-48d1-3e6b-9c20-f240f75ab9ae", "abstract"=>"The association of xenotropic murine leukemia virus (MLV)-related virus (XMRV) in prostate cancer and chronic fatigue syndrome reported in previous studies remains controversial as these results have been questioned by recent data. Nonetheless, concerns have been raised regarding contamination of human vaccines as a possible source of introduction of XMRV and MLV into human populations. To address this possibility, we tested eight live attenuated human vaccines using generic PCR for XMRV and MLV sequences. Viral metagenomics using deep sequencing was also done to identify the possibility of other adventitious agents.", "link"=>"http://www.mendeley.com/research/evidence-murine-leukemia-virusrelated-viruses-live-attenuated-human-vaccines", "reader_count"=>26, "reader_count_by_academic_status"=>{"Student > Doctoral Student"=>2, "Researcher"=>7, "Student > Ph. D. Student"=>7, "Student > Postgraduate"=>1, "Other"=>1, "Student > Master"=>4, "Student > Bachelor"=>3, "Professor"=>1}, "reader_count_by_user_role"=>{"Student > Doctoral Student"=>2, "Researcher"=>7, "Student > Ph. D. Student"=>7, "Student > Postgraduate"=>1, "Other"=>1, "Student > Master"=>4, "Student > Bachelor"=>3, "Professor"=>1}, "reader_count_by_subject_area"=>{"Biochemistry, Genetics and Molecular Biology"=>4, "Agricultural and Biological Sciences"=>11, "Medicine and Dentistry"=>6, "Veterinary Science and Veterinary Medicine"=>1, "Pharmacology, Toxicology and Pharmaceutical Science"=>1, "Chemistry"=>1, "Social Sciences"=>1, "Immunology and Microbiology"=>1}, "reader_count_by_subdiscipline"=>{"Medicine and Dentistry"=>{"Medicine and Dentistry"=>6}, "Chemistry"=>{"Chemistry"=>1}, "Social Sciences"=>{"Social Sciences"=>1}, "Immunology and Microbiology"=>{"Immunology and Microbiology"=>1}, "Agricultural and Biological Sciences"=>{"Agricultural and Biological Sciences"=>11}, "Biochemistry, Genetics and Molecular Biology"=>{"Biochemistry, Genetics and Molecular Biology"=>4}, "Pharmacology, Toxicology and Pharmaceutical Science"=>{"Pharmacology, Toxicology and Pharmaceutical Science"=>1}, "Veterinary Science and Veterinary Medicine"=>{"Veterinary Science and Veterinary Medicine"=>1}}, "reader_count_by_country"=>{"Brazil"=>2}, "group_count"=>0}

Scopus | Further Information

{"@_fa"=>"true", "link"=>[{"@_fa"=>"true", "@ref"=>"self", "@href"=>"https://api.elsevier.com/content/abstract/scopus_id/84055182539"}, {"@_fa"=>"true", "@ref"=>"author-affiliation", "@href"=>"https://api.elsevier.com/content/abstract/scopus_id/84055182539?field=author,affiliation"}, {"@_fa"=>"true", "@ref"=>"scopus", "@href"=>"https://www.scopus.com/inward/record.uri?partnerID=HzOxMe3b&scp=84055182539&origin=inward"}, {"@_fa"=>"true", "@ref"=>"scopus-citedby", "@href"=>"https://www.scopus.com/inward/citedby.uri?partnerID=HzOxMe3b&scp=84055182539&origin=inward"}], "prism:url"=>"https://api.elsevier.com/content/abstract/scopus_id/84055182539", "dc:identifier"=>"SCOPUS_ID:84055182539", "eid"=>"2-s2.0-84055182539", "dc:title"=>"No evidence of murine leukemia virus-related viruses in live attenuated human vaccines", "dc:creator"=>"Switzer W.", "prism:publicationName"=>"PLoS ONE", "prism:eIssn"=>"19326203", "prism:volume"=>"6", "prism:issueIdentifier"=>"12", "prism:pageRange"=>nil, "prism:coverDate"=>"2011-12-22", "prism:coverDisplayDate"=>"22 December 2011", "prism:doi"=>"10.1371/journal.pone.0029223", "citedby-count"=>"9", "affiliation"=>[{"@_fa"=>"true", "affilname"=>"National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention", "affiliation-city"=>nil, "affiliation-country"=>"United States"}], "pubmed-id"=>"22216219", "prism:aggregationType"=>"Journal", "subtype"=>"ar", "subtypeDescription"=>"Article", "article-number"=>"e29223", "source-id"=>"10600153309", "openaccess"=>"1", "openaccessFlag"=>true}

Facebook

  • {"url"=>"http%3A%2F%2Fjournals.plos.org%2Fplosone%2Farticle%3Fid%3D10.1371%252Fjournal.pone.0029223", "share_count"=>0, "like_count"=>0, "comment_count"=>0, "click_count"=>0, "total_count"=>0}

Counter

  • {"month"=>"12", "year"=>"2011", "pdf_views"=>"47", "xml_views"=>"15", "html_views"=>"812"}
  • {"month"=>"1", "year"=>"2012", "pdf_views"=>"94", "xml_views"=>"36", "html_views"=>"296"}
  • {"month"=>"2", "year"=>"2012", "pdf_views"=>"39", "xml_views"=>"20", "html_views"=>"65"}
  • {"month"=>"3", "year"=>"2012", "pdf_views"=>"18", "xml_views"=>"8", "html_views"=>"72"}
  • {"month"=>"4", "year"=>"2012", "pdf_views"=>"28", "xml_views"=>"17", "html_views"=>"95"}
  • {"month"=>"5", "year"=>"2012", "pdf_views"=>"11", "xml_views"=>"0", "html_views"=>"67"}
  • {"month"=>"6", "year"=>"2012", "pdf_views"=>"5", "xml_views"=>"0", "html_views"=>"28"}
  • {"month"=>"7", "year"=>"2012", "pdf_views"=>"13", "xml_views"=>"0", "html_views"=>"32"}
  • {"month"=>"8", "year"=>"2012", "pdf_views"=>"8", "xml_views"=>"5", "html_views"=>"24"}
  • {"month"=>"9", "year"=>"2012", "pdf_views"=>"10", "xml_views"=>"0", "html_views"=>"26"}
  • {"month"=>"10", "year"=>"2012", "pdf_views"=>"6", "xml_views"=>"0", "html_views"=>"25"}
  • {"month"=>"11", "year"=>"2012", "pdf_views"=>"12", "xml_views"=>"0", "html_views"=>"39"}
  • {"month"=>"12", "year"=>"2012", "pdf_views"=>"3", "xml_views"=>"0", "html_views"=>"20"}
  • {"month"=>"1", "year"=>"2013", "pdf_views"=>"7", "xml_views"=>"0", "html_views"=>"25"}
  • {"month"=>"2", "year"=>"2013", "pdf_views"=>"2", "xml_views"=>"1", "html_views"=>"15"}
  • {"month"=>"3", "year"=>"2013", "pdf_views"=>"3", "xml_views"=>"0", "html_views"=>"15"}
  • {"month"=>"4", "year"=>"2013", "pdf_views"=>"6", "xml_views"=>"0", "html_views"=>"20"}
  • {"month"=>"5", "year"=>"2013", "pdf_views"=>"5", "xml_views"=>"0", "html_views"=>"20"}
  • {"month"=>"6", "year"=>"2013", "pdf_views"=>"7", "xml_views"=>"1", "html_views"=>"24"}
  • {"month"=>"7", "year"=>"2013", "pdf_views"=>"2", "xml_views"=>"0", "html_views"=>"15"}
  • {"month"=>"8", "year"=>"2013", "pdf_views"=>"3", "xml_views"=>"1", "html_views"=>"9"}
  • {"month"=>"9", "year"=>"2013", "pdf_views"=>"3", "xml_views"=>"0", "html_views"=>"20"}
  • {"month"=>"10", "year"=>"2013", "pdf_views"=>"2", "xml_views"=>"1", "html_views"=>"25"}
  • {"month"=>"11", "year"=>"2013", "pdf_views"=>"8", "xml_views"=>"2", "html_views"=>"42"}
  • {"month"=>"12", "year"=>"2013", "pdf_views"=>"2", "xml_views"=>"0", "html_views"=>"51"}
  • {"month"=>"1", "year"=>"2014", "pdf_views"=>"1", "xml_views"=>"0", "html_views"=>"25"}
  • {"month"=>"2", "year"=>"2014", "pdf_views"=>"2", "xml_views"=>"0", "html_views"=>"27"}
  • {"month"=>"3", "year"=>"2014", "pdf_views"=>"2", "xml_views"=>"2", "html_views"=>"25"}
  • {"month"=>"4", "year"=>"2014", "pdf_views"=>"3", "xml_views"=>"1", "html_views"=>"28"}
  • {"month"=>"5", "year"=>"2014", "pdf_views"=>"1", "xml_views"=>"0", "html_views"=>"32"}
  • {"month"=>"6", "year"=>"2014", "pdf_views"=>"0", "xml_views"=>"0", "html_views"=>"26"}
  • {"month"=>"7", "year"=>"2014", "pdf_views"=>"2", "xml_views"=>"0", "html_views"=>"51"}
  • {"month"=>"8", "year"=>"2014", "pdf_views"=>"3", "xml_views"=>"2", "html_views"=>"58"}
  • {"month"=>"9", "year"=>"2014", "pdf_views"=>"3", "xml_views"=>"1", "html_views"=>"62"}
  • {"month"=>"10", "year"=>"2014", "pdf_views"=>"7", "xml_views"=>"0", "html_views"=>"41"}
  • {"month"=>"11", "year"=>"2014", "pdf_views"=>"1", "xml_views"=>"3", "html_views"=>"43"}
  • {"month"=>"12", "year"=>"2014", "pdf_views"=>"0", "xml_views"=>"1", "html_views"=>"455"}
  • {"month"=>"1", "year"=>"2015", "pdf_views"=>"1", "xml_views"=>"0", "html_views"=>"177"}
  • {"month"=>"2", "year"=>"2015", "pdf_views"=>"0", "xml_views"=>"0", "html_views"=>"27"}
  • {"month"=>"3", "year"=>"2015", "pdf_views"=>"1", "xml_views"=>"0", "html_views"=>"9"}
  • {"month"=>"4", "year"=>"2015", "pdf_views"=>"1", "xml_views"=>"1", "html_views"=>"11"}
  • {"month"=>"5", "year"=>"2015", "pdf_views"=>"4", "xml_views"=>"0", "html_views"=>"11"}
  • {"month"=>"6", "year"=>"2015", "pdf_views"=>"2", "xml_views"=>"0", "html_views"=>"8"}
  • {"month"=>"7", "year"=>"2015", "pdf_views"=>"1", "xml_views"=>"0", "html_views"=>"11"}
  • {"month"=>"8", "year"=>"2015", "pdf_views"=>"2", "xml_views"=>"2", "html_views"=>"19"}
  • {"month"=>"9", "year"=>"2015", "pdf_views"=>"3", "xml_views"=>"0", "html_views"=>"23"}
  • {"month"=>"10", "year"=>"2015", "pdf_views"=>"1", "xml_views"=>"0", "html_views"=>"30"}
  • {"month"=>"11", "year"=>"2015", "pdf_views"=>"2", "xml_views"=>"0", "html_views"=>"40"}
  • {"month"=>"12", "year"=>"2015", "pdf_views"=>"6", "xml_views"=>"0", "html_views"=>"70"}
  • {"month"=>"1", "year"=>"2016", "pdf_views"=>"5", "xml_views"=>"0", "html_views"=>"45"}
  • {"month"=>"2", "year"=>"2016", "pdf_views"=>"0", "xml_views"=>"0", "html_views"=>"8"}
  • {"month"=>"3", "year"=>"2016", "pdf_views"=>"2", "xml_views"=>"0", "html_views"=>"44"}
  • {"month"=>"4", "year"=>"2016", "pdf_views"=>"1", "xml_views"=>"0", "html_views"=>"17"}
  • {"month"=>"5", "year"=>"2016", "pdf_views"=>"4", "xml_views"=>"0", "html_views"=>"7"}
  • {"month"=>"6", "year"=>"2016", "pdf_views"=>"0", "xml_views"=>"0", "html_views"=>"30"}
  • {"month"=>"7", "year"=>"2016", "pdf_views"=>"2", "xml_views"=>"0", "html_views"=>"27"}
  • {"month"=>"8", "year"=>"2016", "pdf_views"=>"4", "xml_views"=>"0", "html_views"=>"38"}
  • {"month"=>"9", "year"=>"2016", "pdf_views"=>"8", "xml_views"=>"0", "html_views"=>"29"}
  • {"month"=>"10", "year"=>"2016", "pdf_views"=>"4", "xml_views"=>"0", "html_views"=>"34"}
  • {"month"=>"11", "year"=>"2016", "pdf_views"=>"1", "xml_views"=>"0", "html_views"=>"25"}
  • {"month"=>"12", "year"=>"2016", "pdf_views"=>"2", "xml_views"=>"0", "html_views"=>"13"}
  • {"month"=>"1", "year"=>"2017", "pdf_views"=>"0", "xml_views"=>"0", "html_views"=>"10"}
  • {"month"=>"2", "year"=>"2017", "pdf_views"=>"0", "xml_views"=>"0", "html_views"=>"30"}
  • {"month"=>"3", "year"=>"2017", "pdf_views"=>"3", "xml_views"=>"2", "html_views"=>"15"}
  • {"month"=>"4", "year"=>"2017", "pdf_views"=>"3", "xml_views"=>"0", "html_views"=>"25"}
  • {"month"=>"5", "year"=>"2017", "pdf_views"=>"3", "xml_views"=>"2", "html_views"=>"15"}
  • {"month"=>"6", "year"=>"2017", "pdf_views"=>"0", "xml_views"=>"0", "html_views"=>"30"}
  • {"month"=>"7", "year"=>"2017", "pdf_views"=>"3", "xml_views"=>"3", "html_views"=>"26"}
  • {"month"=>"8", "year"=>"2017", "pdf_views"=>"3", "xml_views"=>"0", "html_views"=>"21"}
  • {"month"=>"9", "year"=>"2017", "pdf_views"=>"2", "xml_views"=>"1", "html_views"=>"14"}
  • {"month"=>"10", "year"=>"2017", "pdf_views"=>"0", "xml_views"=>"0", "html_views"=>"24"}
  • {"month"=>"11", "year"=>"2017", "pdf_views"=>"9", "xml_views"=>"1", "html_views"=>"25"}
  • {"month"=>"12", "year"=>"2017", "pdf_views"=>"2", "xml_views"=>"1", "html_views"=>"15"}
  • {"month"=>"1", "year"=>"2018", "pdf_views"=>"1", "xml_views"=>"1", "html_views"=>"15"}
  • {"month"=>"2", "year"=>"2018", "pdf_views"=>"0", "xml_views"=>"0", "html_views"=>"13"}
  • {"month"=>"3", "year"=>"2018", "pdf_views"=>"0", "xml_views"=>"0", "html_views"=>"12"}
  • {"month"=>"4", "year"=>"2018", "pdf_views"=>"3", "xml_views"=>"1", "html_views"=>"10"}
  • {"month"=>"5", "year"=>"2018", "pdf_views"=>"5", "xml_views"=>"1", "html_views"=>"6"}
  • {"month"=>"6", "year"=>"2018", "pdf_views"=>"2", "xml_views"=>"0", "html_views"=>"31"}
  • {"month"=>"7", "year"=>"2018", "pdf_views"=>"0", "xml_views"=>"3", "html_views"=>"8"}
  • {"month"=>"8", "year"=>"2018", "pdf_views"=>"1", "xml_views"=>"1", "html_views"=>"12"}
  • {"month"=>"9", "year"=>"2018", "pdf_views"=>"4", "xml_views"=>"0", "html_views"=>"14"}
  • {"month"=>"10", "year"=>"2018", "pdf_views"=>"2", "xml_views"=>"1", "html_views"=>"14"}
  • {"month"=>"11", "year"=>"2018", "pdf_views"=>"9", "xml_views"=>"0", "html_views"=>"43"}
  • {"month"=>"12", "year"=>"2018", "pdf_views"=>"2", "xml_views"=>"0", "html_views"=>"37"}
  • {"month"=>"1", "year"=>"2019", "pdf_views"=>"6", "xml_views"=>"0", "html_views"=>"35"}
  • {"month"=>"2", "year"=>"2019", "pdf_views"=>"2", "xml_views"=>"0", "html_views"=>"11"}
  • {"month"=>"3", "year"=>"2019", "pdf_views"=>"4", "xml_views"=>"1", "html_views"=>"7"}
  • {"month"=>"4", "year"=>"2019", "pdf_views"=>"7", "xml_views"=>"0", "html_views"=>"16"}
  • {"month"=>"5", "year"=>"2019", "pdf_views"=>"2", "xml_views"=>"0", "html_views"=>"10"}
  • {"month"=>"6", "year"=>"2019", "pdf_views"=>"4", "xml_views"=>"0", "html_views"=>"29"}
  • {"month"=>"7", "year"=>"2019", "pdf_views"=>"5", "xml_views"=>"0", "html_views"=>"25"}
  • {"month"=>"8", "year"=>"2019", "pdf_views"=>"9", "xml_views"=>"0", "html_views"=>"9"}

Figshare

  • {"files"=>["https://ndownloader.figshare.com/files/699549"], "description"=>"1<p>Metagenomic results for vaccines other than JEV were reported previously <a href=\"http://www.plosone.org/article/info:doi/10.1371/journal.pone.0029223#pone.0029223-Victoria1\" target=\"_blank\">[24]</a>.</p>2<p>Distinct gammaretrovirus sequences were obtained that were equidistant from MLV and XMRV.</p>3<p>Not tested.</p>", "links"=>[], "tags"=>["hamster", "dna", "retroviruses", "attenuated"], "article_id"=>369928, "categories"=>["Biotechnology", "Microbiology", "Virology", "Infectious Diseases", "Evolutionary Biology"], "users"=>["William M. Switzer", "HaoQiang Zheng", "Graham Simmons", "Yanchen Zhou", "Shaohua Tang", "Anupama Shankar", "Beatrix Kapusinszky", "Eric L. Delwart", "Walid Heneine"], "doi"=>"https://dx.doi.org/10.1371/journal.pone.0029223.t001", "stats"=>{"downloads"=>0, "page_views"=>7, "likes"=>0}, "figshare_url"=>"https://figshare.com/articles/_Identification_of_Hamster_DNA_and_Retroviruses_in_Eight_Live_Attenuated_Human_Virus_Vaccines_/369928", "title"=>"Identification of Hamster DNA and Retroviruses in Eight Live, Attenuated Human Virus Vaccines.", "pos_in_sequence"=>0, "defined_type"=>3, "published_date"=>"2013-02-20 10:31:31"}
  • {"files"=>["https://ndownloader.figshare.com/files/699210"], "description"=>"<p>Primer positions are relative to an alignment of prototypical murine leukemia viruses (MLV). Primer names and PCR fragments obtained are provided in parentheses. LTR, long terminal repeat; <i>gag</i>, group specific antigen; <i>pro</i>, protease; <i>pol</i>, polymerase; <i>env</i>, envelope. Also shown is the 91-bp overlap region used for phylogenetic analysis of all PCR-amplified fragements. Quantitative PCR with the Taqman primers Pro-UNV-F1 and Pro-UNV-R1 were used to originally detect gammaretroviruses in the JEV vaccine and hamster cell line DNA (fragment 1, 161-bp). Four additional primer sets were used to amplify larger gammaretrovirus sequences for further genetic characterization (Fragments 2–5). Nested PCR was used for obtaining fragments 3–5 and all amplified sequences were about 950-bp in length. Only the inner most primer name combinations are shown. The primers PRO-UNV-OF 5′TAGGGAGGTC AGGGTCAGGAGC3′ and PRO-UNV-OR 5′GGAAAGAGTGRGTGACCT TACCGGT3′ were used to amplify a second fragment (283-bp). The primary PCR amplification for fragment 3 used the primers PRO-UNV-F1 and XPOLIR 5′AAGTGGCGG CCAGCAGTAAGTCAT3′, while the outer primers for fragments 4 and 5 were PRO-UNV-OF and XPOLIR. The internal primers for fragments 3 and 4 were PRO-SA-IF1 5′GAGCAACC AGTCACCTTCCTA3′ and POL-IRM 5′TCTGGGTGCTGGATCCGGAA3′, while the internal primers for fragment 5 were PRO-UNV-IF2 5′ GGGCGCCCRGTCACCTTCCTG3′ and POLIRM.</p>", "links"=>[], "tags"=>["locations", "sizes", "endogenous", "retrovirus", "sequences", "attenuated", "japanese", "encephalitis", "hamster"], "article_id"=>369582, "categories"=>["Biotechnology", "Microbiology", "Virology", "Infectious Diseases", "Evolutionary Biology"], "users"=>["William M. Switzer", "HaoQiang Zheng", "Graham Simmons", "Yanchen Zhou", "Shaohua Tang", "Anupama Shankar", "Beatrix Kapusinszky", "Eric L. Delwart", "Walid Heneine"], "doi"=>"https://dx.doi.org/10.1371/journal.pone.0029223.g001", "stats"=>{"downloads"=>0, "page_views"=>19, "likes"=>0}, "figshare_url"=>"https://figshare.com/articles/_Schematic_showing_locations_and_sizes_of_endogenous_retrovirus_sequences_detected_in_the_live_attenuated_Japanese_encephalitis_virus_JEV_vaccine_SA_14_14_2_and_in_hamster_cell_lines_/369582", "title"=>"Schematic showing locations and sizes of endogenous retrovirus sequences detected in the live, attenuated Japanese encephalitis virus (JEV) vaccine (SA-14-14-2) and in hamster cell lines.", "pos_in_sequence"=>0, "defined_type"=>1, "published_date"=>"2013-02-20 10:29:49"}
  • {"files"=>["https://ndownloader.figshare.com/files/699337"], "description"=>"<p>(a) Phylogenetic inference of 91-bp overlapping (final alignment length is 82-bp) gammaretrovirus DNA sequences PCR-amplified from the JEV SA-14-14-2 vaccine and hamster cell lines (baby hamster kidney (BHK) and Chinese hamster ovary (CHO)) using five different PCR assays. (b) Phylogenetic inference of 910-bp gammaretrovirus DNA sequences PCR-amplified from the JEV SA-14-14-2 vaccine and HAK using three different PCR assays. The new sequences were phylogenetically compared to prototypical gammaretroviruses (GenBank accession numbers in parentheses). MLV, murine leukemia virus; mERV, mouse endogenous retrovirus; FeLV, feline leukemia virus; RaLV, rat leukemia virus; PtrogCERV, Pan troglodytes chimp endogenous retrovirus; GaLV, gibbon ape leukemia virus; KoaRV, koala retrovirus; PERV, porcine endogenous retrovirus. XMRV sequences coded with VP and WPI are from persons with prostate cancer and chronic fatigue syndrome, respectively. X followed by a number in parentheses indicates the number of identical sequences obtained for that fragment. Asterisks indicate sequences without open reading frames. The MLV/XMRV and PERV branches were collapsed to fit the trees to single pages. Stability of the tree topology was tested using 1000 bootstrap replicates in both neighbor joining (NJ) and maximum likelihood (ML) methods. Bootstrap values >60 are shown (NJ/ML). New sequences (fragments 1–4) from the JEV vaccine and hamster cell lines are in light blue and red text, respectively. Fragment 5 sequences amplified from the JEV SA-14-14-2 vaccine are in dark blue text.</p>", "links"=>[], "tags"=>["hamster", "endogenous", "gammaretrovirus", "sequences", "attenuated", "japanese", "encephalitis"], "article_id"=>369708, "categories"=>["Biotechnology", "Microbiology", "Virology", "Infectious Diseases", "Evolutionary Biology"], "users"=>["William M. Switzer", "HaoQiang Zheng", "Graham Simmons", "Yanchen Zhou", "Shaohua Tang", "Anupama Shankar", "Beatrix Kapusinszky", "Eric L. Delwart", "Walid Heneine"], "doi"=>"https://dx.doi.org/10.1371/journal.pone.0029223.g002", "stats"=>{"downloads"=>1, "page_views"=>17, "likes"=>0}, "figshare_url"=>"https://figshare.com/articles/_Identification_of_novel_hamster_endogenous_gammaretrovirus_sequences_in_the_live_attenuated_Japanese_encephalitis_virus_JEV_vaccine_SA_14_14_2_/369708", "title"=>"Identification of novel hamster endogenous gammaretrovirus sequences in the live attenuated Japanese encephalitis virus (JEV) vaccine (SA-14-14-2).", "pos_in_sequence"=>0, "defined_type"=>1, "published_date"=>"2013-02-20 10:30:29"}
  • {"files"=>["https://ndownloader.figshare.com/files/699503"], "description"=>"1<p>Viral filtrates treated with (+) or without (−) DNase and RNase.</p>2<p>IAP, intracisternal A particle; <i>pol</i>, polymerase.</p>3<p>Primers were based on amplicons generated with MLV quantitative protease (q<i>pro</i>) assay.</p>4<p>ext, extended q<i>pro</i> assay and is equivalent to Fragment 2 in <a href=\"http://www.plosone.org/article/info:doi/10.1371/journal.pone.0029223#pone-0029223-g001\" target=\"_blank\">Fig. 1</a>.</p>5<p>Primers were based on amplicons generated with extended q<i>pro</i> assay.</p>6<p>ND, not done.</p>", "links"=>[], "tags"=>["japanese", "encephalitis", "hamster", "endogenous", "retrovirus", "genomic", "dna", "attenuated", "jev"], "article_id"=>369870, "categories"=>["Biotechnology", "Microbiology", "Virology", "Infectious Diseases", "Evolutionary Biology"], "users"=>["William M. Switzer", "HaoQiang Zheng", "Graham Simmons", "Yanchen Zhou", "Shaohua Tang", "Anupama Shankar", "Beatrix Kapusinszky", "Eric L. Delwart", "Walid Heneine"], "doi"=>"https://dx.doi.org/10.1371/journal.pone.0029223.t002", "stats"=>{"downloads"=>3, "page_views"=>13, "likes"=>0}, "figshare_url"=>"https://figshare.com/articles/_Detection_of_Japanese_encephalitis_virus_JEV_RNA_hamster_endogenous_retrovirus_ERV_DNA_and_hamster_genomic_DNA_in_the_live_attenuated_JEV_vaccine_SA_14_14_2_/369870", "title"=>"Detection of Japanese encephalitis virus (JEV) RNA, hamster endogenous retrovirus (ERV) DNA, and hamster genomic DNA in the live, attenuated JEV vaccine (SA-14-14-2).", "pos_in_sequence"=>0, "defined_type"=>3, "published_date"=>"2013-02-20 10:31:15"}

PMC Usage Stats | Further Information

  • {"scanned-page-browse"=>"0", "month"=>"1", "cited-by"=>"0", "abstract"=>"2", "full-text"=>"66", "unique-ip"=>"69", "pdf"=>"45", "year"=>"2012", "figure"=>"11", "scanned-summary"=>"0", "supp-data"=>"0"}
  • {"month"=>"2", "scanned-page-browse"=>"0", "cited-by"=>"0", "abstract"=>"0", "full-text"=>"37", "year"=>"2012", "pdf"=>"18", "unique-ip"=>"42", "figure"=>"7", "scanned-summary"=>"0", "supp-data"=>"0"}
  • {"scanned-page-browse"=>"0", "month"=>"3", "cited-by"=>"0", "abstract"=>"0", "full-text"=>"36", "unique-ip"=>"38", "pdf"=>"15", "year"=>"2012", "figure"=>"5", "scanned-summary"=>"0", "supp-data"=>"0"}
  • {"month"=>"4", "scanned-page-browse"=>"0", "cited-by"=>"0", "abstract"=>"1", "full-text"=>"21", "year"=>"2012", "pdf"=>"10", "unique-ip"=>"19", "figure"=>"2", "scanned-summary"=>"0", "supp-data"=>"0"}
  • {"scanned-page-browse"=>"0", "month"=>"5", "cited-by"=>"0", "abstract"=>"0", "full-text"=>"13", "unique-ip"=>"14", "pdf"=>"8", "year"=>"2012", "figure"=>"0", "scanned-summary"=>"0", "supp-data"=>"0"}
  • {"month"=>"6", "scanned-page-browse"=>"0", "cited-by"=>"0", "abstract"=>"1", "full-text"=>"12", "year"=>"2012", "pdf"=>"8", "unique-ip"=>"11", "figure"=>"0", "scanned-summary"=>"0", "supp-data"=>"0"}
  • {"unique-ip"=>"14", "full-text"=>"16", "pdf"=>"3", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"2", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2012", "month"=>"7"}
  • {"unique-ip"=>"17", "full-text"=>"20", "pdf"=>"4", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"1", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2012", "month"=>"8"}
  • {"unique-ip"=>"8", "full-text"=>"11", "pdf"=>"3", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2012", "month"=>"9"}
  • {"unique-ip"=>"8", "full-text"=>"6", "pdf"=>"1", "abstract"=>"1", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2012", "month"=>"10"}
  • {"unique-ip"=>"9", "full-text"=>"9", "pdf"=>"4", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2012", "month"=>"12"}
  • {"unique-ip"=>"7", "full-text"=>"7", "pdf"=>"0", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2013", "month"=>"1"}
  • {"unique-ip"=>"5", "full-text"=>"3", "pdf"=>"3", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2013", "month"=>"3"}
  • {"unique-ip"=>"13", "full-text"=>"13", "pdf"=>"4", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"1", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2013", "month"=>"2"}
  • {"unique-ip"=>"7", "full-text"=>"10", "pdf"=>"1", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"1", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2013", "month"=>"4"}
  • {"unique-ip"=>"13", "full-text"=>"14", "pdf"=>"5", "abstract"=>"1", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"2", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2012", "month"=>"11"}
  • {"unique-ip"=>"12", "full-text"=>"11", "pdf"=>"5", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"6", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2013", "month"=>"5"}
  • {"unique-ip"=>"11", "full-text"=>"13", "pdf"=>"8", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2013", "month"=>"6"}
  • {"unique-ip"=>"6", "full-text"=>"6", "pdf"=>"3", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2013", "month"=>"7"}
  • {"unique-ip"=>"6", "full-text"=>"4", "pdf"=>"2", "abstract"=>"1", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"1", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2013", "month"=>"8"}
  • {"unique-ip"=>"4", "full-text"=>"4", "pdf"=>"0", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2013", "month"=>"9"}
  • {"unique-ip"=>"9", "full-text"=>"9", "pdf"=>"1", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2013", "month"=>"10"}
  • {"unique-ip"=>"15", "full-text"=>"14", "pdf"=>"4", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2013", "month"=>"11"}
  • {"unique-ip"=>"7", "full-text"=>"7", "pdf"=>"4", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2013", "month"=>"12"}
  • {"unique-ip"=>"8", "full-text"=>"9", "pdf"=>"6", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2014", "month"=>"1"}
  • {"unique-ip"=>"9", "full-text"=>"11", "pdf"=>"0", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2014", "month"=>"2"}
  • {"unique-ip"=>"7", "full-text"=>"7", "pdf"=>"1", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2014", "month"=>"3"}
  • {"unique-ip"=>"4", "full-text"=>"3", "pdf"=>"2", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2014", "month"=>"5"}
  • {"unique-ip"=>"12", "full-text"=>"10", "pdf"=>"8", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"3", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2014", "month"=>"6"}
  • {"unique-ip"=>"4", "full-text"=>"5", "pdf"=>"0", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2014", "month"=>"4"}
  • {"unique-ip"=>"12", "full-text"=>"11", "pdf"=>"3", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"2", "supp-data"=>"0", "cited-by"=>"1", "year"=>"2015", "month"=>"4"}
  • {"unique-ip"=>"7", "full-text"=>"9", "pdf"=>"2", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"2", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2015", "month"=>"5"}
  • {"unique-ip"=>"10", "full-text"=>"9", "pdf"=>"3", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"1", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2015", "month"=>"6"}
  • {"unique-ip"=>"9", "full-text"=>"8", "pdf"=>"2", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2015", "month"=>"7"}
  • {"unique-ip"=>"7", "full-text"=>"7", "pdf"=>"2", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2015", "month"=>"3"}
  • {"unique-ip"=>"7", "full-text"=>"6", "pdf"=>"5", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2015", "month"=>"2"}
  • {"unique-ip"=>"8", "full-text"=>"3", "pdf"=>"5", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"2", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2015", "month"=>"8"}
  • {"unique-ip"=>"10", "full-text"=>"9", "pdf"=>"1", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"1", "year"=>"2015", "month"=>"9"}
  • {"unique-ip"=>"10", "full-text"=>"9", "pdf"=>"3", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2015", "month"=>"10"}
  • {"unique-ip"=>"11", "full-text"=>"12", "pdf"=>"5", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2014", "month"=>"7"}
  • {"unique-ip"=>"6", "full-text"=>"9", "pdf"=>"2", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2014", "month"=>"8"}
  • {"unique-ip"=>"12", "full-text"=>"11", "pdf"=>"8", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"2", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2014", "month"=>"9"}
  • {"unique-ip"=>"15", "full-text"=>"17", "pdf"=>"3", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"1", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2014", "month"=>"10"}
  • {"unique-ip"=>"13", "full-text"=>"12", "pdf"=>"1", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"2", "supp-data"=>"0", "cited-by"=>"1", "year"=>"2016", "month"=>"2"}
  • {"unique-ip"=>"10", "full-text"=>"10", "pdf"=>"3", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"1", "year"=>"2014", "month"=>"11"}
  • {"unique-ip"=>"5", "full-text"=>"5", "pdf"=>"3", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"1", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2014", "month"=>"12"}
  • {"unique-ip"=>"6", "full-text"=>"5", "pdf"=>"4", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2015", "month"=>"1"}
  • {"unique-ip"=>"8", "full-text"=>"5", "pdf"=>"2", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"1", "year"=>"2015", "month"=>"11"}
  • {"unique-ip"=>"12", "full-text"=>"10", "pdf"=>"5", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2015", "month"=>"12"}
  • {"unique-ip"=>"9", "full-text"=>"10", "pdf"=>"0", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2016", "month"=>"1"}
  • {"unique-ip"=>"3", "full-text"=>"5", "pdf"=>"1", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2016", "month"=>"3"}
  • {"unique-ip"=>"8", "full-text"=>"7", "pdf"=>"3", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2016", "month"=>"4"}
  • {"unique-ip"=>"5", "full-text"=>"7", "pdf"=>"1", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2016", "month"=>"5"}
  • {"unique-ip"=>"9", "full-text"=>"5", "pdf"=>"4", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"1", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2016", "month"=>"6"}
  • {"unique-ip"=>"7", "full-text"=>"3", "pdf"=>"4", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"1", "year"=>"2016", "month"=>"7"}
  • {"unique-ip"=>"6", "full-text"=>"8", "pdf"=>"0", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2016", "month"=>"8"}
  • {"unique-ip"=>"3", "full-text"=>"2", "pdf"=>"1", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2016", "month"=>"9"}
  • {"unique-ip"=>"8", "full-text"=>"8", "pdf"=>"2", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2016", "month"=>"10"}
  • {"unique-ip"=>"4", "full-text"=>"2", "pdf"=>"1", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"1", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2016", "month"=>"11"}
  • {"unique-ip"=>"4", "full-text"=>"5", "pdf"=>"0", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2016", "month"=>"12"}
  • {"unique-ip"=>"4", "full-text"=>"1", "pdf"=>"1", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"1", "year"=>"2017", "month"=>"1"}
  • {"unique-ip"=>"1", "full-text"=>"1", "pdf"=>"0", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2017", "month"=>"2"}
  • {"unique-ip"=>"7", "full-text"=>"7", "pdf"=>"0", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2017", "month"=>"3"}
  • {"unique-ip"=>"4", "full-text"=>"4", "pdf"=>"3", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2017", "month"=>"4"}
  • {"unique-ip"=>"7", "full-text"=>"6", "pdf"=>"2", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2017", "month"=>"5"}
  • {"unique-ip"=>"3", "full-text"=>"2", "pdf"=>"3", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2017", "month"=>"6"}
  • {"unique-ip"=>"5", "full-text"=>"5", "pdf"=>"1", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2017", "month"=>"7"}
  • {"unique-ip"=>"1", "full-text"=>"0", "pdf"=>"0", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2017", "month"=>"8"}
  • {"unique-ip"=>"7", "full-text"=>"6", "pdf"=>"1", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2017", "month"=>"10"}
  • {"unique-ip"=>"3", "full-text"=>"3", "pdf"=>"1", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2017", "month"=>"11"}
  • {"unique-ip"=>"2", "full-text"=>"3", "pdf"=>"0", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2017", "month"=>"12"}
  • {"unique-ip"=>"2", "full-text"=>"2", "pdf"=>"0", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2018", "month"=>"1"}
  • {"unique-ip"=>"3", "full-text"=>"3", "pdf"=>"2", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2018", "month"=>"3"}
  • {"unique-ip"=>"11", "full-text"=>"14", "pdf"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2019", "month"=>"1"}
  • {"unique-ip"=>"5", "full-text"=>"5", "pdf"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2018", "month"=>"10"}
  • {"unique-ip"=>"4", "full-text"=>"4", "pdf"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2018", "month"=>"4"}
  • {"unique-ip"=>"12", "full-text"=>"13", "pdf"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2018", "month"=>"5"}
  • {"unique-ip"=>"7", "full-text"=>"8", "pdf"=>"2", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2018", "month"=>"6"}
  • {"unique-ip"=>"8", "full-text"=>"16", "pdf"=>"2", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2018", "month"=>"7"}
  • {"unique-ip"=>"7", "full-text"=>"6", "pdf"=>"3", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2018", "month"=>"8"}
  • {"unique-ip"=>"4", "full-text"=>"4", "pdf"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2018", "month"=>"9"}
  • {"unique-ip"=>"14", "full-text"=>"14", "pdf"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2018", "month"=>"12"}
  • {"unique-ip"=>"15", "full-text"=>"15", "pdf"=>"4", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2018", "month"=>"11"}
  • {"unique-ip"=>"23", "full-text"=>"27", "pdf"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2019", "month"=>"2"}
  • {"unique-ip"=>"14", "full-text"=>"16", "pdf"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2019", "month"=>"3"}
  • {"unique-ip"=>"7", "full-text"=>"7", "pdf"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2019", "month"=>"4"}
  • {"unique-ip"=>"11", "full-text"=>"14", "pdf"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2019", "month"=>"5"}

Relative Metric

{"start_date"=>"2011-01-01T00:00:00Z", "end_date"=>"2011-12-31T00:00:00Z", "subject_areas"=>[{"subject_area"=>"/Biology and life sciences", "average_usage"=>[304, 568, 702, 818, 927, 1027, 1118, 1206, 1285, 1357, 1427, 1500, 1564, 1636, 1705, 1773, 1840, 1909, 1974, 2039, 2106, 2170, 2234, 2296, 2358, 2423, 2484, 2546, 2606, 2673, 2734, 2795, 2857, 2921, 2984, 3046, 3100]}, {"subject_area"=>"/Biology and life sciences/Molecular biology", "average_usage"=>[295, 553, 688, 802, 914, 1017, 1108, 1194, 1278, 1351, 1419, 1500, 1570, 1633, 1712, 1774, 1839, 1903, 1970, 2033, 2101, 2162, 2228, 2291, 2352, 2418, 2486, 2547, 2610, 2680, 2737, 2799, 2859, 2919, 2974, 3029, 3082]}, {"subject_area"=>"/Biology and life sciences/Organisms", "average_usage"=>[316, 571, 699, 812, 915, 1008, 1095, 1180, 1255, 1319, 1393, 1461, 1528, 1595, 1662, 1729, 1802, 1868, 1937, 1997, 2062, 2130, 2192, 2254, 2324, 2386, 2450, 2510, 2579, 2642, 2716, 2778, 2842, 2908, 2979, 3042, 3095]}, {"subject_area"=>"/Medicine and health sciences/Immunology", "average_usage"=>[299, 582, 725, 844, 971, 1076, 1167, 1253, 1328, 1403, 1480, 1551, 1620, 1691, 1756, 1821, 1893, 1962, 2032, 2110, 2178, 2236, 2300, 2358, 2419, 2465, 2529, 2587, 2643, 2700, 2756, 2817, 2869, 2932, 2986, 3046, 3101]}, {"subject_area"=>"/Medicine and health sciences/Public and occupational health", "average_usage"=>[343, 648, 793, 906, 1017, 1126, 1226, 1298, 1386, 1458, 1536, 1617, 1694, 1771, 1851, 1915, 1982, 2042, 2111, 2171, 2220, 2273, 2339, 2430, 2509, 2572, 2640, 2695, 2766, 2822, 2882, 2956, 2992, 3046, 3082, 3151, 3206]}]}
Loading … Spinner
There are currently no alerts